Gene/Protein Characteristic Table for KIAA1385
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00225
Accession No AB037806
Description gephyrin, transcript variant 2
Clone name fj06168
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4193 bp)
Predicted protein sequence (768 aa)
Flexi ORF Clone FXC00225
Source Human fetal brain
Rouge ID mKIAA1385 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4193 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 861 bp
Genome contig ID gi51511730f_65943878
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ACTTAATGAATAAAAAAATTCCTTGATCATTATTT
Flanking genome sequence
(774392 - 774441)
----+----*----+----*----+----*----+----*----+----*
AAAAATGTAATGTGTTGGCCTCGTTATTTAAAGAGAGAAGATTGTCATGC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 14 f 66043878 66718268 20 99.7 Internal No-hit
Features of the protein sequence
Description

Length: 768 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NQX3 0 100.0 Gephyrin.
Homo sapiens
CAA47009 0 99.9 Gephyrin [Rattu...
Rattus norvegicus
CAC81240 0 99.9 gephyrin [Homo ...
Homo sapiens
EDM03692 0 99.7 rCG61772, isofo...
Rattus norvegicus
Q9PW38 0 98.5 Gephyrin.
Gallus gallus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001453 539 680 PD002460 Molybdopterin binding domain
HMMPfam IPR001453 50 196 PF00994 Molybdopterin binding domain
IPR005110 355 521 PF03453 MoeA
IPR001453 534 677 PF00994 Molybdopterin binding domain
IPR005111 690 766 PF03454 MoeA
HMMTigr IPR001453 46 192 TIGR00177 Molybdopterin binding domain
IPR001453 530 673 TIGR00177 Molybdopterin binding domain
ScanRegExp IPR008284 113 126 PS01078 Molybdenum cofactor biosynthesis protein
IPR008284 607 642 PS01079 Molybdenum cofactor biosynthesis protein
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCAAAGCAAGGTTATCATGTG
Primer_r GTACTGTTCTGTCTTTGGAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp