KIAA1390

Product ID	ORK00226
Accession No	AB037811
Description	family with sequence similarity 63, member A, transcript variant 1
Clone name	hh08938
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5222 bp) Predicted protein sequence (505 aa)
HaloTag ORF Clone	FHC00226
Flexi ORF Clone	FXC00226
Source	Human adult brain
Rouge ID	mKIAA1390 by Kazusa Mouse cDNA Project

Length: 5222 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3659 bp
Genome contig ID	gi89161185r_149132310
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTATGAGAGATTTTTAAATAAAAACTTTTAATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTCCTGTGTTTTTTTTTTTCTGTGCACCAGTGTTGTCATCAATTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	149232310	149241870	10	99.1	Perfect prediction

Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG63364	1.3e-190	99.2	unnamed protein...	Homo sapiens
Q8N5J2	7.1e-179	100.0	Protein FAM63A.	Homo sapiens
Q5R7G8	1.5e-172	96.4	Protein FAM63A.	Pongo abelii
XP_001929700	8e-153	87.5	similar to Y55F...	Sus scrofa
XP_001491201	8e-153	87.3	similar to Y55F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032990	2.2e-54	58.2	KIAA1164

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007518	179	304	PF04424	Protein of unknown function DUF544

Primer_f	GATAGGGTTCAAGGTTGTGTG
Primer_r	AGCAATGTTTCAGCCTAAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GATAGGGTTCAAGGTTGTGTG
Primer_r	AGCAATGTTTCAGCCTAAGGG
PCR product length	116 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles