KIAA1164

Product ID	ORK04977
Accession No	AB032990
Description	family with sequence similarity 63, member B
Clone name	hk00541
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4097 bp) Predicted protein sequence (390 aa)
Source	Human adult brain
Rouge ID	mKIAA1164 by Kazusa Mouse cDNA Project

Length: 4097 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2923 bp
Genome contig ID	gi51511731f_56751576
PolyA signal sequence (AATAGA,-21)	+--------+--------+----*----+---- ATGCAAGCCTGGGCAATAGAGCGAGACTCCGTCTC
Flanking genome sequence (185450 - 185499)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATTAGAGCTATTGTGTCTTTATTTTCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	56851576	56937024	9	99.3	Perfect prediction

Length: 390 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW77546	2.3e-146	100.0	family with seq...	Homo sapiens
XP_510443	1.2e-145	99.7	hypothetical pr...	Pan troglodytes
Q8NBR6	1.2e-145	99.7	Protein FAM63B.	Homo sapiens
BAG59761	2.3e-145	99.5	unnamed protein...	Homo sapiens
XP_001918192	7.9e-143	98.2	similar to Y55F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037811	2.4e-57	58.3	KIAA1390

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007518	42	167	PF04424	Protein of unknown function DUF544

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	35	PCPLLAILNVLLLAWK	50	PRIMARY	16

Primer_f	ACAATCTGGGAATAGTGAACG
Primer_r	TTAGGAAATCAGGCACAGACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACAATCTGGGAATAGTGAACG
Primer_r	TTAGGAAATCAGGCACAGACG
PCR product length	194 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles