KIAA1405

Product ID	ORK05750
Accession No	AB037826
Description	kinesin family member 17
Clone name	fg03134s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3570 bp) Predicted protein sequence (993 aa)
Source	Human fetal brain
Rouge ID	mKIAA1405 by Kazusa Mouse cDNA Project
Note	We replaced fg03134, former representative clones for KIAA1405 with fg03134s1. (2002/12/27)

Length: 3570 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	568 bp
Genome contig ID	gi89161185r_20763096
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCACATTAAGCTGCCCAATAAACTGCTTTTAAGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTCCCCTTCTCTGACCCTCTGACAGTGTCACTTGGGGCCCCTCCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	20863096	20916571	15	99.6	Perfect prediction

Length: 993 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAR33039	99.9	kinesin isoform...	Homo sapiens
Q9P2E2	99.8	Kinesin-like pr...	Homo sapiens
CAM12850	99.6	kinesin family ...	Homo sapiens
AAH65927	99.7	Kinesin family ...	Homo sapiens
EAW94944	99.8	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002357	2.6e-46	40.0	KIAA0359
AB014606	1.2e-30	29.4	KIAA0706
AB014539	6.3e-30	47.3	KIAA0639
AB040881	8.8e-30	29.9	KIAA1448
AB011103	2.8e-27	28.8	KIAA0531

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	46	67	PR00380	Kinesin
	IPR001752	165	182	PR00380	Kinesin
	IPR001752	199	217	PR00380	Kinesin
	IPR001752	249	270	PR00380	Kinesin
HMMPfam	IPR001752	6	300	PF00225	Kinesin
HMMSmart	IPR001752	6	307	SM00129	Kinesin
ProfileScan	IPR001752	41	229	PS50067	Kinesin
ScanRegExp	IPR001752	198	209	PS00411	Kinesin

Primer_f	GAAGATTCTGCGTGAGTCCTG
Primer_r	TTTTCACTGTTGCTCCGACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-