Gene/Protein Characteristic Table for KIAA1442
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00838
Accession No AB037863
Description early B-cell factor 4
Clone name hh10127b
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (2782 bp)
Predicted protein sequence (627 aa)
Flexi ORF Clone FXC00838
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 2782 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 897 bp
Genome contig ID gi51511747f_2521689
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGTGGTGCCCGCCCGGCCTCTCACCTGCCTCCTT
Flanking genome sequence
(167060 - 167109)
----+----*----+----*----+----*----+----*----+----*
GGTGTGAGTTTGCTTTTCTTAGCAGTTCAGCAGCTCTAGGGGAGGCTCCA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 20 f 2621524 2688747 18 99.6 Perfect prediction
Features of the protein sequence
Description

Length: 627 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX10577 1.4e-206 99.5 hCG39626, isofo...
Homo sapiens
CAM20111 6.9e-184 90.3 early B-cell fa...
Mus musculus
BAG10068 9.2e-178 100.0 early B-cell fa...
synthetic construct
XP_001713773 1.8e-177 99.8 early B-cell fa...
Homo sapiens
NP_001103984 1.6e-166 95.2 early B-cell fa...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002909 339 421 PF01833 Cell surface receptor IPT/TIG
HMMSmart IPR002909 338 422 SM00429 Cell surface receptor IPT/TIG
ScanRegExp IPR003523 245 254 PS01345 Transcription factor COE
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTATAACAATGGACTGCGGAC
Primer_r CCGCATTCTTCAGGCAGTTCT
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 20
Experimental conditions
Panel name GeneBridge 4
Primer_f CACTTCCTTTGAGACCTGCAC
Primer_r GGAAGACCCCAAATACAGGAG
PCR product length 115 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp