Gene/Protein Characteristic Table for KIAA1450
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01168
Accession No AB040883
Description folliculin interacting protein 2
Clone name fh12401b
Vector information
The cDNA fragment was inserted at the NotI site of the
cDNA sequence DNA sequence (4570 bp)
Predicted protein sequence (1139 aa)
Flexi ORF Clone FXC01168
Source Human fetal brain
Rouge ID mKIAA1450 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4570 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1150 bp
Genome contig ID gi89161207f_159809740
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TAAAACCGACCAAAATGATTTCCTAAAGTTCATGC
Flanking genome sequence
(236558 - 236607)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACAACCTAATTTTCTGTTAATATAAAAGAAACTTC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 4 f 159909740 160046296 17 99.7 Perfect prediction
Features of the protein sequence
Description

Length: 1139 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001498983 0 84.5 folliculin inte...
 Equus caballus
XP_227287 0 78.4 similar to CG37...
 Rattus norvegicus
Q80TD3 0 78.3 Folliculin-inte...
 Mus musculus
XP_001510294 0 67.3 similar to hCG1...
 Ornithorhynchus...
EDL15464 0 72.9 mCG20638 [Mus m...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075841 2.2e-72 50.3 KIAA1961
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AACCCAAGAATCAATGTAGCC
Primer_r AGAACTTACCAACCGAAACAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f AACCCAAGAATCAATGTAGCC
Primer_r AGAACTTACCAACCGAAACAC
PCR product length 179 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp