Gene/Protein Characteristic Table for KIAA1961
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06592
Accession No AB075841
Description folliculin interacting protein 1
Clone name hk07733
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4180 bp)
Predicted protein sequence (943 aa)
Source Human adult brain
Rouge ID mKIAA1961 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4180 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1348 bp
Genome contig ID gi51511721r_130906937
PolyA signal sequence
(ATTAAA,-11)
+----*----+----*----+----*----+----
ATTTTCATCATAATTTCATCATTGATTAAAAAAAG
Flanking genome sequence
(99992 - 99943)
----+----*----+----*----+----*----+----*----+----*
AAAACCACTTGTTTATTCAGTTATTAAATATATTTACTATATAACACATC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 r 131006929 131080193 12 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 943 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001161848 0 99.9 hypothetical pr...
Pan troglodytes
NP_001008738 0 99.9 folliculin inte...
Homo sapiens
AAZ65854 0 97.1 folliculin-inte...
Homo sapiens
XP_001161688 0 99.9 hypothetical pr...
Pan troglodytes
Q8TF40 0 97.0 Folliculin-inte...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040883 8e-84 50.3 KIAA1450
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGATTTCTCCTTCTGACTGCC
Primer_r CACTCTGCCATGTTTCCTCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp