KIAA1961

Product ID	ORK06592
Accession No	AB075841
Description	folliculin interacting protein 1
Clone name	hk07733
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4180 bp) Predicted protein sequence (943 aa)
Source	Human adult brain
Rouge ID	mKIAA1961 by Kazusa Mouse cDNA Project

Length: 4180 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1348 bp
Genome contig ID	gi51511721r_130906937
PolyA signal sequence (ATTAAA,-11)	+--------+--------+----*----+---- ATTTTCATCATAATTTCATCATTGATTAAAAAAAG
Flanking genome sequence (99992 - 99943)	----+--------+--------+--------+--------+----* AAAACCACTTGTTTATTCAGTTATTAAATATATTTACTATATAACACATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	131006929	131080193	12	99.3	Perfect prediction

Length: 943 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001161848	99.9	hypothetical pr...	Pan troglodytes
NP_001008738	99.9	folliculin inte...	Homo sapiens
AAZ65854	97.1	folliculin-inte...	Homo sapiens
XP_001161688	99.9	hypothetical pr...	Pan troglodytes
Q8TF40	97.0	Folliculin-inte...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040883	8e-84	50.3	KIAA1450

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TGATTTCTCCTTCTGACTGCC
Primer_r	CACTCTGCCATGTTTCCTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-