KIAA1499

Gene/Protein Characteristic Table for KIAA1499

Order Kazusa clone(s) from :

Product ID	ORK00853
Accession No	AB040932
Description	nuclear protein localization 4 homolog (S. cerevisiae)
Clone name	hh04716
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5551 bp) Predicted protein sequence (660 aa)
HaloTag ORF Clone	FHC00853
Flexi ORF Clone	FXC00853
Source	Human adult brain
Rouge ID	mKIAA1499 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5551 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3567 bp
Genome contig ID	gi51511734r_77039376
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGGTGAAGCCCCGTCTGTACAAAAAAACAATATT
Flanking genome sequence (99860 - 99811)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAATTAGCTGGGCATGGTGAGTGGTCCACGCCTATAATCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	77139236	77214491	16	97.9	Perfect prediction

Features of the protein sequence

Description

Length: 660 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW89663	100.0	nuclear protein...	Homo sapiens
Q8TAT6	97.9	Nuclear protein...	Homo sapiens
BAA91314	97.1	unnamed protein...	Homo sapiens
XP_001489914	97.3	nuclear protein...	Equus caballus
P60670	96.2	Nuclear protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007716	147	289	PF05020	NPL4
HMMPfam	IPR007717	291	600	PF05021	NPL4

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGTCCAGGCCGTACGTCTTAG
Primer_r	ACTAAAGGGAAATTCTCAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	CCR
Primer_f	TGTCCAGGCCGTACGTCTTAG
Primer_r	ACTAAAGGGAAATTCTCAAGG
PCR product length	181 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp