KIAA1563

Product ID	ORK00865
Accession No	AB046783
Description	amyotrophic lateral sclerosis 2 (juvenile), transcript variant 1
Clone name	fh20460s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh20460s1 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6348 bp) Predicted protein sequence (1658 aa)
HaloTag ORF Clone	FHC00865
Flexi ORF Clone	FXC00865
Source	Human fetal brain
Rouge ID	mKIAA1563 by Kazusa Mouse cDNA Project
Note	We replaced fh20460, former representative clones for KIAA1563 with fh20460s1. (2002/5/10)

Length: 6348 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1297 bp
Genome contig ID	gi89161199r_202173522
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AACAGCAATTTTCATAATAAAAGGCATTCATCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGGTTGTTTTATGATTGTAGAAGAAATGAACAGGGCAGCCTAAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	202273522	202341919	33	99.8	Terminal No-hit

Length: 1658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96Q42	100.0	Alsin; Amyotrop...	Homo sapiens
NP_065970	99.9	alsin isoform 1...	Homo sapiens
Q5BIW4	99.8	Alsin; Amyotrop...	Pan troglodytes
AAL14103	99.9	alsin [Homo sap...	Homo sapiens
EAW70291	99.6	amyotrophic lat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D25215	3.4e-10	35.6	KIAA0032
AB040903	7.7e-08	28.3	KIAA1470
AB046813	7.4e-06	32.4	KIAA1593
AB037838	0.00011	30.7	KIAA1417

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	528	544	PR00633	Regulator of chromosome condensation
	IPR000408	562	575	PR00633	Regulator of chromosome condensation
	IPR000408	581	597	PR00633	Regulator of chromosome condensation
HMMPfam	IPR003409	1050	1072	PF02493	MORN motif
	IPR003409	1073	1095	PF02493	MORN motif
	IPR003409	1101	1123	PF02493	MORN motif
	IPR003409	1124	1146	PF02493	MORN motif
	IPR003409	1152	1174	PF02493	MORN motif
	IPR003409	1176	1198	PF02493	MORN motif
	IPR003409	1199	1221	PF02493	MORN motif
	IPR003409	1222	1245	PF02493	MORN motif
	IPR003123	1553	1657	PF02204	Vacuolar sorting protein 9
HMMSmart	IPR003409	1048	1069	SM00698	MORN motif
	IPR003409	1071	1092	SM00698	MORN motif
	IPR003409	1099	1120	SM00698	MORN motif
	IPR003409	1122	1143	SM00698	MORN motif
	IPR003409	1150	1171	SM00698	MORN motif
	IPR003409	1174	1195	SM00698	MORN motif
	IPR003409	1197	1218	SM00698	MORN motif
	IPR003409	1220	1242	SM00698	MORN motif
ProfileScan	IPR000408	61	110	PS50012	Regulator of chromosome condensation
	IPR000408	111	169	PS50012	Regulator of chromosome condensation
	IPR000408	170	220	PS50012	Regulator of chromosome condensation
	IPR000408	527	578	PS50012	Regulator of chromosome condensation
	IPR000408	579	629	PS50012	Regulator of chromosome condensation
	IPR000219	691	886	PS50010	DH
	IPR003123	1514	1658	PS51205	Vacuolar sorting protein 9
ScanRegExp	IPR000408	156	166	PS00626	Regulator of chromosome condensation
ScanRegExp	IPR000408	207	217	PS00626	Regulator of chromosome condensation

Primer_f	ATGTTACTACCAGATTCAGCG
Primer_r	GTAAGGCTCATTCTAACAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-