KIAA1572

Product ID	ORK00866
Accession No	AB046792
Description	zinc finger and BTB domain containing 26, transcript variant 1
Clone name	fh23424
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5609 bp) Predicted protein sequence (492 aa)
HaloTag ORF Clone	FHC00866
Flexi ORF Clone	FXC00866
Source	Human fetal brain
Rouge ID	mKIAA1572 by Kazusa Mouse cDNA Project

Length: 5609 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3040 bp
Genome contig ID	gi89161216r_124617669
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TATGGGGAAGTTTCCTTAATAAAAGTGTGACGATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCTCTGGTGTCATTGGTTATTTTCTCACTCTCCCCTCCTTCTATTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	124717669	124723277	1	99.0	Perfect prediction

Length: 492 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW87553	4.2e-202	100.0	hCG1645834 [Hom...	Homo sapiens
XP_548463	1.6e-181	100.0	similar to zinc...	Canis lupus fam...
XP_520241	1.6e-181	100.0	zinc finger pro...	Pan troglodytes
XP_001087270	2e-181	100.0	similar to zinc...	Macaca mulatta
Q9HCK0	1.4e-180	100.0	Zinc finger and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075842	4.3e-09	38.0	KIAA1962
AB023189	5.5e-09	32.0	KIAA0972
AB028943	5.7e-09	26.5	KIAA1020
AB075859	6.5e-09	39.8	KIAA1979
AB007901	1.2e-08	24.7	KIAA0441

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	74	178	PF00651	BTB/POZ
	IPR007087	324	346	PF00096	Zinc finger
	IPR007087	349	371	PF00096	Zinc finger
	IPR007087	377	399	PF00096	Zinc finger
	IPR007087	405	428	PF00096	Zinc finger
HMMSmart	IPR000210	84	178	SM00225	BTB/POZ-like
	IPR015880	324	346	SM00355	Zinc finger
	IPR015880	349	371	SM00355	Zinc finger
	IPR015880	377	399	SM00355	Zinc finger
	IPR015880	405	428	SM00355	Zinc finger
ProfileScan	IPR000210	84	148	PS50097	BTB/POZ-like
	IPR007087	324	346	PS50157	Zinc finger
	IPR007087	349	376	PS50157	Zinc finger
	IPR007087	377	404	PS50157	Zinc finger
	IPR007087	405	428	PS50157	Zinc finger
ScanRegExp	IPR007087	326	346	PS00028	Zinc finger
	IPR007087	351	371	PS00028	Zinc finger
	IPR007087	379	399	PS00028	Zinc finger
	IPR007087	407	428	PS00028	Zinc finger
	IPR001220	444	450	PS00307	Legume lectin

Primer_f	CACCCATGAGTTAGATTTAGG
Primer_r	GAAGGAAGAAGATGCTAGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-