KIAA0441

Product ID	ORK00537
Accession No	AB007901
Description	zinc finger and BTB domain containing 24, transcript variant 1
Clone name	hh00601s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (5597 bp) Predicted protein sequence (702 aa)
HaloTag ORF Clone	FHC00537
Flexi ORF Clone	FXC00537
Source	Human adult brain
Rouge ID	mKIAA0441 by Kazusa Mouse cDNA Project
Note	We replaced hh00601, former representative clones for KIAA0441 with hh00601s1. (2002/5/10)

Length: 5597 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3335 bp
Genome contig ID	gi89161210r_109790412
PolyA signal sequence (CATAAA,-21)	+--------+--------+----*----+---- CTTATCTAGGTTTTCATAAATGGGAATGTAACAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTCCAAATATGGAGTCCTTACTATTGTCCAGGAGCCAAGCCAGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	109890412	109911133	7	99.1	Perfect prediction

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09740	100.0	zinc finger and...	synthetic construct
O43167	99.9	Zinc finger and...	Homo sapiens
XP_001153734	99.4	zinc finger and...	Pan troglodytes
XP_001088667	98.1	zinc finger and...	Macaca mulatta
XP_590553	93.7	similar to Zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023189	9.2e-28	35.7	KIAA0972
AB037852	6.6e-27	41.0	KIAA1431
AB046831	1.2e-26	44.2	KIAA1611
AB075849	2.3e-26	35.2	KIAA1969
AB075836	2.5e-26	44.5	KIAA1956

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	300	322	PD000003	Zinc finger
	IPR007087	327	350	PD000003	Zinc finger
	IPR007087	439	461	PD000003	Zinc finger
HMMPfam	IPR013069	32	138	PF00651	BTB/POZ
	IPR000637	164	176	PF02178	HMG-I and HMG-Y
	IPR007087	299	321	PF00096	Zinc finger
	IPR007087	327	349	PF00096	Zinc finger
	IPR007087	355	377	PF00096	Zinc finger
	IPR007087	383	405	PF00096	Zinc finger
	IPR007087	411	433	PF00096	Zinc finger
	IPR007087	439	461	PF00096	Zinc finger
	IPR007087	467	489	PF00096	Zinc finger
	IPR007087	495	517	PF00096	Zinc finger
HMMSmart	IPR000210	42	138	SM00225	BTB/POZ-like
	IPR015880	299	321	SM00355	Zinc finger
	IPR015880	327	349	SM00355	Zinc finger
	IPR015880	355	377	SM00355	Zinc finger
	IPR015880	383	405	SM00355	Zinc finger
	IPR015880	411	433	SM00355	Zinc finger
	IPR015880	439	461	SM00355	Zinc finger
	IPR015880	467	489	SM00355	Zinc finger
	IPR015880	495	517	SM00355	Zinc finger
ProfileScan	IPR000210	42	108	PS50097	BTB/POZ-like
	IPR007087	299	326	PS50157	Zinc finger
	IPR007087	327	354	PS50157	Zinc finger
	IPR007087	355	382	PS50157	Zinc finger
	IPR007087	383	410	PS50157	Zinc finger
	IPR007087	411	438	PS50157	Zinc finger
	IPR007087	439	466	PS50157	Zinc finger
	IPR007087	467	494	PS50157	Zinc finger
	IPR007087	495	522	PS50157	Zinc finger
ScanRegExp	IPR007087	301	321	PS00028	Zinc finger
	IPR007087	329	349	PS00028	Zinc finger
	IPR007087	357	377	PS00028	Zinc finger
	IPR007087	385	405	PS00028	Zinc finger
	IPR007087	413	433	PS00028	Zinc finger
	IPR007087	441	461	PS00028	Zinc finger
	IPR007087	469	489	PS00028	Zinc finger
	IPR007087	497	517	PS00028	Zinc finger

Primer_f	TTCAAGAAGCACTGGGCAAGC
Primer_r	TAGAATGTTATGCTTTGGGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCAAGAAGCACTGGGCAAGC
Primer_r	TAGAATGTTATGCTTTGGGGC
PCR product length	152 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles