KIAA0972

Product ID	ORK02008
Accession No	AB023189
Description	zinc finger protein 510
Clone name	hj06859
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5154 bp) Predicted protein sequence (702 aa)
HaloTag ORF Clone	FHC02008
Flexi ORF Clone	FXC02008
Source	Human adult brain

Length: 5154 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2913 bp
Genome contig ID	gi89161216r_98457968
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCATGTACTGTACAAAATAAAGGTCTCTTTATCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGCTTCCATTGATGTCATTGGATATAAGAATTTACAAAACTTTTTTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	98557968	98578351	5	100.0	Terminal No-hit

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2H8	0	100.0	Zinc finger pro...	Homo sapiens
XP_001153252	0	98.0	zinc finger pro...	Pan troglodytes
AAH68587	0	100.0	ZNF510 protein ...	Homo sapiens
AAH58022	1.6e-191	100.0	ZNF510 protein ...	Homo sapiens
XP_001113504	1.9e-166	87.1	zinc finger pro...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075836	1.4e-54	36.7	KIAA1956
D31763	2.4e-53	49.0	KIAA0065
AB051497	2.6e-53	50.0	KIAA1710
AB075827	1.6e-52	37.5	KIAA1947
AB046831	2e-52	39.6	KIAA1611

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	423	446	PD000003	Zinc finger
	IPR007087	451	474	PD000003	Zinc finger
	IPR007087	479	502	PD000003	Zinc finger
	IPR007087	507	530	PD000003	Zinc finger
	IPR007087	535	558	PD000003	Zinc finger
	IPR007087	563	586	PD000003	Zinc finger
	IPR007087	591	614	PD000003	Zinc finger
	IPR007087	619	642	PD000003	Zinc finger
	IPR007087	647	670	PD000003	Zinc finger
HMMPfam	IPR001909	65	105	PF01352	KRAB box
	IPR007087	423	445	PF00096	Zinc finger
	IPR007087	451	473	PF00096	Zinc finger
	IPR007087	479	501	PF00096	Zinc finger
	IPR007087	507	529	PF00096	Zinc finger
	IPR007087	535	557	PF00096	Zinc finger
	IPR007087	563	585	PF00096	Zinc finger
	IPR007087	591	613	PF00096	Zinc finger
	IPR007087	619	641	PF00096	Zinc finger
	IPR007087	647	669	PF00096	Zinc finger
HMMSmart	IPR001909	65	125	SM00349	KRAB box
	IPR015880	273	295	SM00355	Zinc finger
	IPR015880	423	445	SM00355	Zinc finger
	IPR015880	451	473	SM00355	Zinc finger
	IPR015880	479	501	SM00355	Zinc finger
	IPR015880	507	529	SM00355	Zinc finger
	IPR015880	535	557	SM00355	Zinc finger
	IPR015880	563	585	SM00355	Zinc finger
	IPR015880	591	613	SM00355	Zinc finger
	IPR015880	619	641	SM00355	Zinc finger
	IPR015880	647	669	SM00355	Zinc finger
ProfileScan	IPR001909	65	136	PS50805	KRAB box
	IPR007087	273	300	PS50157	Zinc finger
	IPR007087	423	450	PS50157	Zinc finger
	IPR007087	451	478	PS50157	Zinc finger
	IPR007087	479	506	PS50157	Zinc finger
	IPR007087	507	534	PS50157	Zinc finger
	IPR007087	535	562	PS50157	Zinc finger
	IPR007087	563	590	PS50157	Zinc finger
	IPR007087	591	618	PS50157	Zinc finger
	IPR007087	619	646	PS50157	Zinc finger
	IPR007087	647	674	PS50157	Zinc finger
ScanRegExp	IPR007087	425	445	PS00028	Zinc finger
	IPR007087	453	473	PS00028	Zinc finger
	IPR007087	481	501	PS00028	Zinc finger
	IPR007087	509	529	PS00028	Zinc finger
	IPR007087	537	557	PS00028	Zinc finger
	IPR007087	565	585	PS00028	Zinc finger
	IPR007087	593	613	PS00028	Zinc finger
	IPR007087	621	641	PS00028	Zinc finger
	IPR007087	649	669	PS00028	Zinc finger

Primer_f	TTTAGGAGTTTGTCGTCTTGG
Primer_r	GAGACAGCTACTACTATTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTTAGGAGTTTGTCGTCTTGG
Primer_r	GAGACAGCTACTACTATTGCC
PCR product length	150 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles