KIAA1577

Gene/Protein Characteristic Table for KIAA1577

Order Kazusa clone(s) from :

Product ID	ORK07531
Accession No	AB046797
Description	zinc finger, SWIM-type containing 6
Clone name	fj03457
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4087 bp) Predicted protein sequence (743 aa)
Source	Human fetal brain
Rouge ID	mKIAA1577 by Kazusa Mouse cDNA Project

Length: 4087 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1853 bp
Genome contig ID	gi51511721f_60752928
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTTTTGTTTTGATTAAAATTAGTTTTTTGAAAGTT
Flanking genome sequence (124828 - 124877)	----+--------+--------+--------+--------+----* GATTCTGCCTCCTTTATGGTATATCTCTTATTGCACCTGAATTTGGTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	60852928	60877754	10	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 743 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW51397	100.0	hCG18020 [Homo ...	Homo sapiens
NP_065979	100.0	zinc finger, SW...	Homo sapiens
XP_001492530	98.9	similar to Zinc...	Equus caballus
XP_583205	98.5	zinc finger, SW...	Bos taurus
BAC29905	98.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040944	0	74.6	KIAA1511
AB020720	0.0003	26.8	KIAA0913

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ATTGGGGTTCGTGCCTCCTAG
Primer_r	GCTCACTGCAAAGGCGTAATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 5

Experimental conditions

Panel name	CCR
Primer_f	AGAAAGTTTGCCGGAATGAGG
Primer_r	AGGAGAGAGGTGAAGAGATAC
PCR product length	196 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp