Gene/Protein Characteristic Table for KIAA1577
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07531
Accession No AB046797
Description zinc finger, SWIM-type containing 6
Clone name fj03457
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4087 bp)
Predicted protein sequence (743 aa)
Source Human fetal brain
Rouge ID mKIAA1577 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1853 bp
Genome contig ID gi51511721f_60752928
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTTTTGTTTTGATTAAAATTAGTTTTTTGAAAGTT
Flanking genome sequence
(124828 - 124877)
----+----*----+----*----+----*----+----*----+----*
GATTCTGCCTCCTTTATGGTATATCTCTTATTGCACCTGAATTTGGTGAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 f 60852928 60877754 10 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 743 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW51397 0 100.0 hCG18020 [Homo ...
Homo sapiens
NP_065979 0 100.0 zinc finger, SW...
Homo sapiens
XP_001492530 0 98.9 similar to Zinc...
Equus caballus
XP_583205 0 98.5 zinc finger, SW...
Bos taurus
BAC29905 0 98.1 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040944 0 74.6 KIAA1511
AB020720 0.0003 26.8 KIAA0913
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATTGGGGTTCGTGCCTCCTAG
Primer_r GCTCACTGCAAAGGCGTAATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name CCR
Primer_f AGAAAGTTTGCCGGAATGAGG
Primer_r AGGAGAGAGGTGAAGAGATAC
PCR product length 196 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp