Order Kazusa clone(s) from : ![]() |
Product ID | ORK00872 |
---|---|
Accession No | AB046807 |
Description | melanoma antigen family E1 |
Clone name | fj08327 |
Vector information | |
cDNA sequence | DNA sequence (3628 bp) Predicted protein sequence (991 aa) |
HaloTag ORF Clone |
FHC00872
![]() |
Flexi ORF Clone | FXC00872 |
Source | Human fetal brain |
Rouge ID |
mKIAA1587
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 547 bp |
---|---|
Genome contig ID | gi89161218f_75464521 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (103629 - 103678) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 198 | 324 | PD041608 | NULL |
IPR008165 | 325 | 423 | PD003992 | Protein of unknown function GLTT | |
NULL | 424 | 471 | PD041608 | NULL | |
HMMPfam | IPR002190 | 532 | 702 | PF01454 | MAGE protein |
IPR002190 | 786 | 948 | PF01454 | MAGE protein | |
ProfileScan | IPR002190 | 525 | 724 | PS50838 | MAGE protein |
IPR002190 | 779 | 970 | PS50838 | MAGE protein |
![]() |
Primer_f | GTTTACGGGTTCCTGACAGTG |
---|---|
Primer_r | AACATCAGCTCTATTGGCCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |