Order Kazusa clone(s) from : ![]() |
Product ID | ORK00934 |
---|---|
Accession No | AB058762 |
Description | melanoma antigen family D4B, transcript variant 1 |
Clone name | bm01165 |
Vector information | |
cDNA sequence | DNA sequence (2576 bp) Predicted protein sequence (761 aa) |
HaloTag ORF Clone |
FHC00934
![]() |
Flexi ORF Clone | FXC00934 |
Source | Human adult brain |
Note | We replaced fh15135, former representative clones for KIAA1859 with bm01165. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 200 bp |
---|---|
Genome contig ID | gi89161218f_51844683 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107421 - 107470) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TCTTCGATTTCACTCAGCCGG |
---|---|
Primer_r | CTGCTGCCACAACATTCTGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |