KIAA1606

Product ID	ORK05324
Accession No	AB046826
Description	gon-4-like (C. elegans)
Clone name	fj10873
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4155 bp) Predicted protein sequence (1095 aa)
Source	Human fetal brain
Rouge ID	mKIAA1606 by Kazusa Mouse cDNA Project

Length: 4155 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	866 bp
Genome contig ID	gi89161185r_153750269
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGCCATAGGGTGAATAAAGGAATGTTTAACTGTG
Flanking genome sequence (235865 - 235816)	----+--------+--------+--------+--------+----* GACTTTTTCAGCACTTTTAATCCAGGAATGGAGATAGTAAAACCTCTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	153986134	154002453	12	99.8	Perfect prediction

Length: 1095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW53030	100.0	gon-4-like (C.e...	Homo sapiens
Q3T8J9	99.9	GON-4-like prot...	Homo sapiens
BAF51556	99.6	YY1AP-related p...	Homo sapiens
XP_513864	99.1	Dingo protein [...	Pan troglodytes
XP_001915796	87.2	gon-4-like (C. ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003822	501	549	PF02671	Paired amphipathic helix
HMMPfam	IPR003822	583	630	PF02671	Paired amphipathic helix
ProfileScan	IPR001005	1010	1055	PS50090	SANT

Primer_f	CTACAACATATCCCTGGCAAG
Primer_r	CTCAGGTAACAGGAAAGCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-