KIAA1695

Product ID	ORK05022
Accession No	AB051482
Description	formin homology 2 domain containing 3
Clone name	fj11471
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4126 bp) Predicted protein sequence (1199 aa)
Source	Human fetal brain
Rouge ID	mKIAA1695 by Kazusa Mouse cDNA Project

Length: 4126 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	525 bp
Genome contig ID	gi51511735f_32328747
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGTTTCAAATACTAAATAAATAGAGTTTAATGCC
Flanking genome sequence (285271 - 285320)	----+--------+--------+--------+--------+----* ATAATGAGAAACTTTTATTCTTCTGGGAACAGGACCTTAAACAGTTCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	32428747	32614016	18	100.0	Perfect prediction

Length: 1199 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01381	100.0	formin homology...	Homo sapiens
XP_001106575	98.7	similar to form...	Macaca mulatta
AAI57094	96.9	Formin homology...	synthetic construct
XP_001106689	95.7	similar to form...	Macaca mulatta
EAX01379	98.6	formin homology...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002379	4.9e-09	26.1	KIAA0381
AB051514	1.1e-06	24.9	KIAA1727
AB095934	1.2e-05	21.7	KIAA2014

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015425	661	1031	PF02181	Actin-binding FH2
HMMSmart	IPR003104	660	1105	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	1	248	PS51232	GTPase-binding/formin homology 3
ProfileScan	IPR014767	1136	1168	PS51231	Diaphanous autoregulatory

Primer_f	TCTCTTGATTCCGTGACACCC
Primer_r	ATTTTGGTGTTGTGGAGACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-