KIAA0381

Product ID	ORK00063
Accession No	AB002379
Description	dishevelled associated activator of morphogenesis 2, transcript variant 1
Clone name	ah04695
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6177 bp) Predicted protein sequence (1114 aa)
HaloTag ORF Clone	FHC00063
Flexi ORF Clone	FXC00063
Source	Human brain (amygdala)
Rouge ID	mKIAA0381 by Kazusa Mouse cDNA Project
Note	We replaced hh00540, former representative clones for KIAA0381 with ah04695. (2005/08/06)

Length: 6177 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2831 bp
Genome contig ID	gi89161210f_39768137
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TACTAAAAAATATTAAATTCATACCATCCCTACCC
Flanking genome sequence (212487 - 212536)	----+--------+--------+--------+--------+----* AGTCTGCCTTTAAACTTGTGCCTTCTTCCTATGAGGGGATCTGGGGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	39868137	39980622	25	100.0	Perfect prediction

Length: 1114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001113947	99.1	dishevelled ass...	Macaca mulatta
Q86T65	100.0	Disheveled-asso...	Homo sapiens
EAX03996	99.9	dishevelled ass...	Homo sapiens
XP_518453	97.4	dishevelled ass...	Pan troglodytes
CAD89973	99.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014566	1.3e-71	67.7	KIAA0666
AB067489	2.2e-16	26.7	KIAA1902
AB095934	4.7e-16	26.8	KIAA2014
AB051482	1.1e-07	26.1	KIAA1695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	86	275	PF06371	Diaphanous GTPase-binding
	IPR010472	277	483	PF06367	Diaphanous FH3
	IPR015425	642	1015	PF02181	Actin-binding FH2
HMMSmart	IPR003104	641	1084	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	86	462	PS51232	GTPase-binding/formin homology 3
ProfileScan	IPR014767	1062	1094	PS51231	Diaphanous autoregulatory

Primer_f	AAGGTGCAAGTGAAAAAGGAC
Primer_r	ATCTCCCCCGACTTCTACCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGGTGCAAGTGAAAAAGGAC
Primer_r	ATCTCCCCCGACTTCTACCAG
PCR product length	117 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles