KIAA1902

Product ID	ORK01184
Accession No	AB067489
Description	formin-like 2
Clone name	hj04383
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5344 bp) Predicted protein sequence (1112 aa)
HaloTag ORF Clone	FHC01184
Flexi ORF Clone	FXC01184
Source	Human adult brain
Rouge ID	mKIAA1902 by Kazusa Mouse cDNA Project

Length: 5344 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1927 bp
Genome contig ID	gi89161199f_152800229
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GAGCAAATAATAAACTATTTACACTACTATTCTGT
Flanking genome sequence (414365 - 414414)	----+--------+--------+--------+--------+----* AATATGTTGTAATCTTTCAATGGTACAATTTAGGGGGTTTTAGCAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	152900229	153214592	26	99.8	Perfect prediction

Length: 1112 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11370	100.0	formin-like pro...	synthetic construct
XP_515836	99.9	formin-like 2 i...	Pan troglodytes
AAI67804	99.8	Formin-like 2 [...	synthetic construct
Q96PY5	99.0	Formin-like pro...	Homo sapiens
XP_001139667	98.9	formin-like 2 i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095934	9.6e-45	69.8	KIAA2014
AB002379	1.7e-13	26.9	KIAA0381
AB014566	2.9e-11	26.9	KIAA0666

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000976	523	539	PR00049	Wilm's tumour protein
FPrintScan	IPR000976	572	586	PR00049	Wilm's tumour protein
HMMPfam	IPR010473	42	295	PF06371	Diaphanous GTPase-binding
	IPR010472	297	503	PF06367	Diaphanous FH3
	IPR015425	637	1002	PF02181	Actin-binding FH2
HMMSmart	IPR003104	636	1073	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	42	488	PS51232	GTPase-binding/formin homology 3
ProfileScan	IPR014767	1059	1098	PS51231	Diaphanous autoregulatory

Primer_f	GCTTCTGGCTTATCTTCTTGG
Primer_r	ACTACACATCCAAGGAAAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-