KIAA1720

Gene/Protein Characteristic Table for KIAA1720

Order Kazusa clone(s) from :

Product ID	ORK00899
Accession No	AB051507
Description	SH3-binding domain protein 5-like
Clone name	pf00447
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2893 bp) Predicted protein sequence (421 aa)
HaloTag ORF Clone	FHC00899
Flexi ORF Clone	FXC00899
Source	Human brain (hippocampus)
Rouge ID	mKIAA1720 by Kazusa Mouse cDNA Project

Length: 2893 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1452 bp
Genome contig ID	gi89161185r_246971270
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GGTTTTATTTAAATAAAGTAGTTTATGTAACAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATCTACTGTCCTTGCTGGAGGAAGAGAAAAGGGGCAAAGATGAGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	247071270	247086016	6	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7L8J4	5.6e-132	100.0	SH3 domain-bind...	Homo sapiens
XP_001107738	3.7e-131	99.2	similar to SH3-...	Macaca mulatta
Q5R9X9	6.6e-130	98.7	SH3 domain-bind...	Pongo abelii
EDM04540	6.3e-126	95.7	rCG34685, isofo...	Rattus norvegicus
Q99LH9	1.4e-123	94.7	SH3 domain-bind...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	88	301	PD023692	NULL
HMMPfam	IPR007940	80	316	PF05276	SH3-binding 5

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GGCAGTGCTCCCAGTTTGTAG
Primer_r	AACCTCCCTCAACCTGTAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	CCR
Primer_f	GGCAGTGCTCCCAGTTTGTAG
Primer_r	AACCTCCCTCAACCTGTAGAC
PCR product length	179 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp