KIAA1723

Product ID	ORK00902
Accession No	AB051510
Description	DLC1 Rho GTPase activating protein, transcript variant 1
Clone name	pf00881
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7365 bp) Predicted protein sequence (1554 aa)
HaloTag ORF Clone	FHC00902
Flexi ORF Clone	FXC00902
Source	Human brain (hippocampus)

Length: 7365 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2448 bp
Genome contig ID	gi51511724r_12885362
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTAGGCACCTAATAAATTTATTATTTGCTATACTG
Flanking genome sequence (99881 - 99832)	----+--------+--------+--------+--------+----* AACTGATTGGATTAGCTTCTGTTACTGCAAAGGGAAGAGCATCTAGGATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	12985243	13416686	18	99.3	Perfect prediction

Length: 1554 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10131	100.0	Rho GTPase-acti...	synthetic construct
EAW63855	99.9	deleted in live...	Homo sapiens
BAF84371	99.8	unnamed protein...	Homo sapiens
AAH54511	99.7	Deleted in live...	Homo sapiens
ACE86794	99.7	deleted in live...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D80011	1.1e-104	42.5	KIAA0189
AB037735	8.3e-08	25.5	KIAA1314
D50921	1.2e-07	30.4	KIAA0131
AB014572	1.6e-07	32.3	KIAA0672
AB051509	3e-07	30.1	KIAA1722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	474	541	PF07647	Sterile alpha motif homology 2
	IPR000198	1118	1264	PF00620	RhoGAP
	IPR002913	1349	1548	PF01852	Lipid-binding START
HMMSmart	IPR000198	1115	1307	SM00324	RhoGAP
HMMSmart	IPR002913	1349	1550	SM00234	Lipid-binding START
ProfileScan	IPR000198	1104	1310	PS50238	RhoGAP
ProfileScan	IPR002913	1340	1525	PS50848	Lipid-binding START

Primer_f	CGCTTTATTTGCAGTGTGTTG
Primer_r	AGACATCTATTGCCATTCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-