Gene/Protein Characteristic Table for KIAA1314
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04157
Accession No AB037735
Description Rho GTPase activating protein 28
Clone name fh12718
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5369 bp)
Predicted protein sequence (681 aa)
Source Human fetal brain
Rouge ID mKIAA1314 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5369 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 18 f 6778493 6888718 17 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 681 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX01633 0 100.0 Rho GTPase acti...
Homo sapiens
EAX01634 0 99.1 Rho GTPase acti...
Homo sapiens
Q9P2N2 0 100.0 Rho GTPase-acti...
Homo sapiens
XP_512034 0 99.1 Rho GTPase acti...
Pan troglodytes
XP_547665 0 89.9 similar to Rho ...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051510 2.1e-10 25.2 KIAA1723
D29642 3.9e-09 26.7 KIAA0053
AB051509 1.9e-08 29.3 KIAA1722
D80011 3.2e-08 26.1 KIAA0189
D87717 8.2e-08 26.2 KIAA0013
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000198 358 511 PF00620 RhoGAP
HMMSmart IPR000198 355 533 SM00324 RhoGAP
ProfileScan IPR000198 339 536 PS50238 RhoGAP
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCCAAGACTTCAAAGGTACTG
Primer_r GAGAGAAGTGGAGCATGGACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 18
Experimental conditions
Panel name GeneBridge 4
Primer_f CCCAAGACTTCAAAGGTACTG
Primer_r GAGAGAAGTGGAGCATGGACC
PCR product length 95(1.6k) bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp