Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04152 |
---|---|
Accession No | D87717 |
Description | Rho GTPase activating protein 11A |
Clone name | ha00450s1 |
Vector information | |
cDNA sequence | DNA sequence (5616 bp) Predicted protein sequence (1086 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0013
by Kazusa Mouse cDNA Project
|
Note | We replaced ha00450, former representative clones for KIAA0013 with ha00450s1. (2008/8/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1822 bp |
---|---|
Genome contig ID | gi51511731f_28605598 |
PolyA signal sequence (AATGAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (2113564 - 2113613) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | TAGGTTGTAGAGGAAGGAAT |
Primer_r | ATGCTGTAAGTCTGGTTGCT |
PCR product length | 141 bp |
PCR conditions | 95 °C15 sec60 °C60 sec30 cycles |