KIAA1796

Product ID	ORK06352
Accession No	AB058699
Description	phytanoyl-CoA 2-hydroxylase interacting protein-like
Clone name	fj18826
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4742 bp) Predicted protein sequence (245 aa)
Source	Human fetal brain
Rouge ID	mKIAA1796 by Kazusa Mouse cDNA Project

Length: 4742 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4004 bp
Genome contig ID	gi89161187f_60566339
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCCAGGTGACAGAGTGAGACTCCGTCTCAAAAG
Flanking genome sequence (167580 - 167629)	----+--------+--------+--------+--------+----* AAACAGAAAAGTGTCTGTTCATGTCCTTTGCCTACTTCTTTTATGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	60666339	60733917	7	98.5	Internal No-hit

Length: 245 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAQ88529	4.1e-111	100.0	EELP6309 [Homo ...	Homo sapiens
EAW54184	4.3e-111	100.0	phytanoyl-CoA 2...	Homo sapiens
Q96FC7	4.5e-111	100.0	Phytanoyl-CoA h...	Homo sapiens
AAY18942	4.7e-111	100.0	DKFZp761M0113 [...	synthetic construct
XP_001502143	5.1e-111	99.6	phytanoyl-CoA 2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87463	9.5e-85	75.1	KIAA0273

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AGCATTTAGGGTCTGTCTTAC
Primer_r	GAACCACCACAATTTAGACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-