KIAA0273

Product ID	ORK00487
Accession No	D87463
Description	phytanoyl-CoA 2-hydroxylase interacting protein, transcript variant 2
Clone name	ha06723
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3040 bp) Predicted protein sequence (356 aa)
HaloTag ORF Clone	FHC00487
Flexi ORF Clone	FXC00487
Source	Human adult brain

Length: 3040 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1644 bp
Genome contig ID	gi51511724r_22033167
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAACCACCATGGCCTGAGGGCCCTGCTCGTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCCATTTGAGCTGCTGTAACAAAATACCACACATTGGGTGGCTCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	22133167	22145505	6	99.1	Perfect prediction

Length: 356 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001106477	3.1e-164	100.0	phytanoyl-CoA h...	Macaca mulatta
XP_528082	3.3e-164	100.0	phytanoyl-CoA h...	Pan troglodytes
XP_543252	5.8e-154	97.9	similar to Phyt...	Canis lupus fam...
AAH30494	1.2e-152	98.2	Phyhip protein ...	Mus musculus
Q92561	2.6e-151	100.0	Phytanoyl-CoA h...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058699	1.1e-76	75.1	KIAA1796

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003961	30	131	PF00041	Fibronectin
ProfileScan	IPR003961	29	134	PS50853	Fibronectin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTGAGGGACAGGTGGACAACG
Primer_r	CTGGGCCATGTTCTCTCCTTC
PCR product length	131 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles