Gene/Protein Characteristic Table for KIAA1807
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06343
Accession No AB058710
Description jade family PHD finger 1
Clone name fk00712
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3140 bp)
Predicted protein sequence (702 aa)
Source Human fetal brain
Rouge ID mKIAA1807 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3140 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1030 bp
Genome contig ID gi89161207f_129889708
PolyA signal sequence
(AAGAAA,-14)
+----*----+----*----+----*----+----
AAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAAAAG
Flanking genome sequence
(124191 - 124240)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAAGAGAAAAAAGCGAAATAGGTTATATTTTAAAAACAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 4 f 129989708 130013897 7 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 702 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001158185 0 100.0 PHD finger prot...
Pan troglodytes
EAX05170 0 100.0 PHD finger prot...
Homo sapiens
BAC86931 0 100.0 unnamed protein...
Homo sapiens
BAG65104 0 100.0 unnamed protein...
Homo sapiens
Q6IE81 0 100.0 Protein Jade-1;...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D87076 7.6e-63 49.4 KIAA0239
D86969 3.8e-60 45.1 KIAA0215
AB033112 2.1e-27 33.7 KIAA1286
AB020683 2.9e-14 38.3 KIAA0876
AB018326 3.1e-13 27.7 KIAA0783
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001965 65 113 PF00628 Zinc finger
IPR001965 174 201 PF00628 Zinc finger
HMMSmart IPR001965 65 111 SM00249 Zinc finger
IPR001965 174 229 SM00249 Zinc finger
ProfileScan IPR001965 63 113 PS50016 Zinc finger
ScanRegExp IPR001965 66 110 PS01359 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AATATAGCAGTCAGGGAAGAG
Primer_r CTACTTCAACTGCCCTTATTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp