Order Kazusa clone(s) from : ![]() |
Product ID | ORK06343 |
---|---|
Accession No | AB058710 |
Description | jade family PHD finger 1 |
Clone name | fk00712 |
Vector information | |
cDNA sequence | DNA sequence (3140 bp) Predicted protein sequence (702 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1807
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1030 bp |
---|---|
Genome contig ID | gi89161207f_129889708 |
PolyA signal sequence (AAGAAA,-14) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (124191 - 124240) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 129989708 | 130013897 | 7 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 65 | 113 | PF00628 | Zinc finger |
IPR001965 | 174 | 201 | PF00628 | Zinc finger | |
HMMSmart | IPR001965 | 65 | 111 | SM00249 | Zinc finger |
IPR001965 | 174 | 229 | SM00249 | Zinc finger | |
ProfileScan | IPR001965 | 63 | 113 | PS50016 | Zinc finger |
ScanRegExp | IPR001965 | 66 | 110 | PS01359 | Zinc finger |
![]() |
Primer_f | AATATAGCAGTCAGGGAAGAG |
---|---|
Primer_r | CTACTTCAACTGCCCTTATTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |