KIAA0783

Product ID	ORK01995
Accession No	AB018326
Description	PHD finger protein 14, transcript variant 2
Clone name	hk05408
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4231 bp) Predicted protein sequence (899 aa)
HaloTag ORF Clone	FHC01995
Flexi ORF Clone	FXC01995
Source	Human adult brain
Rouge ID	mKIAA0783 by Kazusa Mouse cDNA Project

Length: 4231 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1157 bp
Genome contig ID	gi89161213f_10880069
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATTTTCTGATTAATAAATGTGGTTTTGGACATCT
Flanking genome sequence (229740 - 229789)	----+--------+--------+--------+--------+----* TTTCGGGTATAGTGACAATGGAAAATAGTTTAAACTTTAGGAATAGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	10980069	11109807	17	99.8	Perfect prediction

Length: 899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94880	100.0	PHD finger prot...	Homo sapiens
NP_055475	99.9	PHD finger prot...	Homo sapiens
EAW93636	100.0	PHD finger prot...	Homo sapiens
NP_001007158	99.9	PHD finger prot...	Homo sapiens
XP_001084293	99.3	PHD finger prot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87076	2.3e-07	25.0	KIAA0239
AB058710	3.6e-07	27.7	KIAA1807
AB033112	0.0001	25.5	KIAA1286
AB014577	0.00024	31.4	KIAA0677
AB020683	0.00025	30.1	KIAA0876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	332	391	PF00628	Zinc finger
HMMPfam	IPR001965	738	790	PF00628	Zinc finger
HMMSmart	IPR001965	332	389	SM00249	Zinc finger
	IPR001965	451	510	SM00249	Zinc finger
	IPR001965	738	788	SM00249	Zinc finger
ProfileScan	IPR001965	330	391	PS50016	Zinc finger
ProfileScan	IPR001965	736	790	PS50016	Zinc finger
ScanRegExp	IPR001965	333	388	PS01359	Zinc finger
ScanRegExp	IPR001965	739	787	PS01359	Zinc finger

Primer_f	ATACCCTTCATGAGACCCAAC
Primer_r	TTCTATCCAAACCTGACAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-