KIAA0876

Product ID	ORK00669
Accession No	AB020683
Description	lysine (K)-specific demethylase 4B
Clone name	hh03683
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5595 bp) Predicted protein sequence (1119 aa)
HaloTag ORF Clone	FHC00669
Flexi ORF Clone	FXC00669
Source	Human adult brain
Rouge ID	mKIAA0876 by Kazusa Mouse cDNA Project
Note	We replaced hk07354, former representative clones for KIAA0876 with hh03683. (2001/5/29)

Length: 5595 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2086 bp
Genome contig ID	gi42406306f_4820132
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GGTTCATAATGAATTAAAGGTTCATGAACGCTGCG
Flanking genome sequence (284476 - 284525)	----+--------+--------+--------+--------+----* AAACCCCGTTCCATGCCCCGGCAAGTGTCTTCATTTCTGAGCCTGTGCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	4920132	5104606	23	99.5	Perfect prediction

Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69181	100.0	jumonji domain ...	Homo sapiens
O94953	99.9	JmjC domain-con...	Homo sapiens
XP_001140503	99.5	jumonji domain ...	Pan troglodytes
XP_001083379	97.5	jumonji domain ...	Macaca mulatta
XP_533946	87.8	similar to Jumo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018323	2.8e-55	54.7	KIAA0780
AB014577	2.8e-51	50.9	KIAA0677
D87072	8.9e-08	33.9	KIAA0234
AB033112	4e-07	36.8	KIAA1286
D87076	6.3e-07	38.0	KIAA0239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	39	84	PF02375	Transcription factor jumonji
	IPR013129	199	315	PF02373	Transcription factor jumonji
	IPR001965	780	814	PF00628	Zinc finger
HMMSmart	IPR003349	37	79	SM00545	Transcription factor jumonji
	IPR003347	166	332	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
	IPR001965	754	812	SM00249	Zinc finger
	IPR001965	874	930	SM00249	Zinc finger
	IPR002999	940	997	SM00333	Tudor
	IPR002999	998	1054	SM00333	Tudor
ProfileScan	IPR003349	38	80	PS51183	Transcription factor jumonji
ProfileScan	IPR003347	169	332	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	GCCCTTCTGGTTGGTAGTGAG
Primer_r	TTCTCTATCAGCTCAACCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCCCTTCTGGTTGGTAGTGAG
Primer_r	TTCTCTATCAGCTCAACCCAC
PCR product length	212 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles