KIAA0780

Product ID	ORK00635
Accession No	AB018323
Description	lysine (K)-specific demethylase 4C
Clone name	hk05362
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk05362 has an irregular adapter sequence (GTCGACCCAC GCGGCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4182 bp) Predicted protein sequence (1100 aa)
HaloTag ORF Clone	FHC00635
Flexi ORF Clone	FXC00635
Source	Human adult brain
Rouge ID	mKIAA0780 by Kazusa Mouse cDNA Project

Length: 4182 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	878 bp
Genome contig ID	gi89161216f_6648061
PolyA signal sequence (CATAAA,-34)	+--------+--------+----*----+---- ACATAAACTACACTAACAATAGCTGATGAGCTACC
Flanking genome sequence (512858 - 512907)	----+--------+--------+--------+--------+----* TAAAAAAAAAAAAAAAAAAAGCAAAAAAAAACTCATAATGTTTTAAGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	6748061	7160917	21	99.6	Perfect prediction

Length: 1100 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09844	100.0	jmjC domain-con...	synthetic construct
CAH73283	99.9	jumonji domain ...	Homo sapiens
EAW58730	99.5	jumonji domain ...	Homo sapiens
XP_001144111	99.2	jumonji domain ...	Pan troglodytes
AAI04860	99.7	Jumonji domain ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020683	4.9e-90	54.7	KIAA0876
AB014577	5e-85	55.2	KIAA0677
D87072	1.9e-14	33.2	KIAA0234
D86969	3.5e-12	40.4	KIAA0215
AB033112	8.1e-12	40.5	KIAA1286

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	70	115	PF02375	Transcription factor jumonji
HMMPfam	IPR013129	230	346	PF02373	Transcription factor jumonji
HMMSmart	IPR003349	68	110	SM00545	Transcription factor jumonji
	IPR003347	197	363	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
	IPR001965	742	800	SM00249	Zinc finger
	IPR001965	862	918	SM00249	Zinc finger
	IPR002999	930	987	SM00333	Tudor
	IPR002999	988	1044	SM00333	Tudor
ProfileScan	IPR003349	69	111	PS51183	Transcription factor jumonji
ProfileScan	IPR003347	197	363	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	AGATGAAGAGTTACCCAAGAG
Primer_r	AAACATGAGGTGAGGACAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGATGAAGAGTTACCCAAGAG
Primer_r	AAGCCCAAGTATGTTTCCTGC
PCR product length	132 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles