Gene/Protein Characteristic Table for KIAA1854
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06894
Accession No AB058757
Description SLIT and NTRK-like family, member 2
Clone name fg02232
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5954 bp)
Predicted protein sequence (572 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 5954 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161218f_144607381
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGTGACTTGCGAATCTCCTGCTAAGCATGCAGGGG
Flanking genome sequence
(105955 - 106004)
----+----*----+----*----+----*----+----*----+----*
AGATACTAAAATTTCTGGGGAGGGAGGCTATCTGTCCAGACAGCCCAAAC
Features of the protein sequence
Description

Length: 572 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI41645 0 100.0 SLIT and NTRK-l...
Homo sapiens
BAC03566 0 100.0 unnamed protein...
Homo sapiens
AAQ89187 0 100.0 LSGV9197 [Homo ...
Homo sapiens
XP_001087022 0 100.0 similar to SLIT...
Macaca mulatta
Q9H156 0 100.0 SLIT and NTRK-l...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB067497 2.6e-76 46.4 KIAA1910
AB020725 1.3e-48 56.9 KIAA0918
AB020655 4.8e-45 50.3 KIAA0848
AB011538 2.5e-12 26.8 KIAA0814
AB011537 2e-11 26.7 KIAA0813
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 189 202 PR00019 Leucine-rich repeat
IPR001611 428 441 PR00019 Leucine-rich repeat
HMMPfam IPR001611 93 115 PF00560 Leucine-rich repeat
IPR001611 117 139 PF00560 Leucine-rich repeat
IPR001611 141 163 PF00560 Leucine-rich repeat
IPR001611 165 187 PF00560 Leucine-rich repeat
IPR001611 188 208 PF00560 Leucine-rich repeat
IPR000372 345 378 PF01462 Leucine-rich repeat
IPR001611 406 428 PF00560 Leucine-rich repeat
IPR001611 430 452 PF00560 Leucine-rich repeat
IPR001611 454 476 PF00560 Leucine-rich repeat
IPR001611 478 500 PF00560 Leucine-rich repeat
IPR001611 501 523 PF00560 Leucine-rich repeat
HMMSmart IPR000372 34 70 SM00013 Leucine-rich repeat
IPR003591 95 114 SM00369 Leucine-rich repeat
IPR003591 115 138 SM00369 Leucine-rich repeat
IPR003591 139 162 SM00369 Leucine-rich repeat
IPR003591 163 186 SM00369 Leucine-rich repeat
IPR003591 187 210 SM00369 Leucine-rich repeat
IPR000483 222 270 SM00082 Cysteine-rich flanking region
IPR000372 345 382 SM00013 Leucine-rich repeat
IPR003591 404 427 SM00369 Leucine-rich repeat
IPR003591 428 451 SM00369 Leucine-rich repeat
IPR003591 452 475 SM00369 Leucine-rich repeat
IPR003591 476 499 SM00369 Leucine-rich repeat
IPR003591 500 523 SM00369 Leucine-rich repeat
IPR000483 535 572 SM00082 Cysteine-rich flanking region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 4 CLKMLSGVWFLSVLTVAGILQTE 26 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCTCTGACCTTTGATGCTTTG
Primer_r GGCAGGTGAGAAAAATGGTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp