Order Kazusa clone(s) from : ![]() |
Product ID | ORK06894 |
---|---|
Accession No | AB058757 |
Description | SLIT and NTRK-like family, member 2 |
Clone name | fg02232 |
Vector information | |
cDNA sequence | DNA sequence (5954 bp) Predicted protein sequence (572 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 0 bp |
---|---|
Genome contig ID | gi89161218f_144607381 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105955 - 106004) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 189 | 202 | PR00019 | Leucine-rich repeat |
IPR001611 | 428 | 441 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 93 | 115 | PF00560 | Leucine-rich repeat |
IPR001611 | 117 | 139 | PF00560 | Leucine-rich repeat | |
IPR001611 | 141 | 163 | PF00560 | Leucine-rich repeat | |
IPR001611 | 165 | 187 | PF00560 | Leucine-rich repeat | |
IPR001611 | 188 | 208 | PF00560 | Leucine-rich repeat | |
IPR000372 | 345 | 378 | PF01462 | Leucine-rich repeat | |
IPR001611 | 406 | 428 | PF00560 | Leucine-rich repeat | |
IPR001611 | 430 | 452 | PF00560 | Leucine-rich repeat | |
IPR001611 | 454 | 476 | PF00560 | Leucine-rich repeat | |
IPR001611 | 478 | 500 | PF00560 | Leucine-rich repeat | |
IPR001611 | 501 | 523 | PF00560 | Leucine-rich repeat | |
HMMSmart | IPR000372 | 34 | 70 | SM00013 | Leucine-rich repeat |
IPR003591 | 95 | 114 | SM00369 | Leucine-rich repeat | |
IPR003591 | 115 | 138 | SM00369 | Leucine-rich repeat | |
IPR003591 | 139 | 162 | SM00369 | Leucine-rich repeat | |
IPR003591 | 163 | 186 | SM00369 | Leucine-rich repeat | |
IPR003591 | 187 | 210 | SM00369 | Leucine-rich repeat | |
IPR000483 | 222 | 270 | SM00082 | Cysteine-rich flanking region | |
IPR000372 | 345 | 382 | SM00013 | Leucine-rich repeat | |
IPR003591 | 404 | 427 | SM00369 | Leucine-rich repeat | |
IPR003591 | 428 | 451 | SM00369 | Leucine-rich repeat | |
IPR003591 | 452 | 475 | SM00369 | Leucine-rich repeat | |
IPR003591 | 476 | 499 | SM00369 | Leucine-rich repeat | |
IPR003591 | 500 | 523 | SM00369 | Leucine-rich repeat | |
IPR000483 | 535 | 572 | SM00082 | Cysteine-rich flanking region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | CLKMLSGVWFLSVLTVAGILQTE | 26 | PRIMARY | 23 |
---|
![]() |
Primer_f | CCTCTGACCTTTGATGCTTTG |
---|---|
Primer_r | GGCAGGTGAGAAAAATGGTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |