KIAA1899

Product ID	ORK00945
Accession No	AB067486
Description	tubulin, gamma complex associated protein 5, transcript variant 1
Clone name	fk06803s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-686) was subcloned upstream of the cDNA (687-3761). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTTGATT-5' end of cDNA
cDNA sequence	DNA sequence (3761 bp) Predicted protein sequence (1032 aa)
HaloTag ORF Clone	FHC00945
Flexi ORF Clone	FXC00945
Source	Human fetal brain
Rouge ID	mKIAA1899 by Kazusa Mouse cDNA Project
Note	We replaced fk06803, former representative clones for KIAA1899 with fk06803s1. (2002/12/27)

Length: 3761 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	642 bp
Genome contig ID	gi51511731f_20284923
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACTGATATTCAAAATAAATTAAAGGACTTAAAATC
Flanking genome sequence (140410 - 140459)	----+--------+--------+--------+--------+----* ATTTTATTATCCTTTTGCTGCTGTCCTACAGTCACAGAAGCTTTTTATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	20384922	20425331	23	99.9	Perfect prediction

Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96RT8	100.0	Gamma-tubulin c...	Homo sapiens
BAF82548	99.9	unnamed protein...	Homo sapiens
AAH71560	99.9	Tubulin, gamma ...	Homo sapiens
NP_001096080	99.6	tubulin, gamma ...	Homo sapiens
XP_536154	92.8	similar to Gamm...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007259	278	922	PF04130	Spc97/Spc98

Primer_f	GAGGAACTTGCAGAAATTGAG
Primer_r	AGGGTGTTAAGCAGGTGAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-