Order Kazusa clone(s) from : ![]() |
Product ID | ORK01183 |
---|---|
Accession No | AB067488 |
Description | NIMA-related kinase 1, transcript variant 2 |
Clone name | hh03635 |
Vector information | |
cDNA sequence | DNA sequence (5497 bp) Predicted protein sequence (1265 aa) |
HaloTag ORF Clone |
FHC01183
![]() |
Flexi ORF Clone | FXC01183 |
Source | Human adult brain |
Rouge ID |
mKIAA1901
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1228 bp |
---|---|
Genome contig ID | gi89161207r_170451006 |
PolyA signal sequence (ATTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 170551006 | 170770189 | 34 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 11 | 255 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 11 | 265 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 11 | 264 | SM00219 | Tyrosine protein kinase |
IPR002290 | 11 | 265 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 11 | 265 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 17 | 40 | PS00107 | Protein kinase |
IPR008271 | 131 | 143 | PS00108 | Serine/threonine protein kinase |
![]() |
Primer_f | AGATTTACAAGAGCTGCAGGC |
---|---|
Primer_r | CTTCGTTCAGGGCACTTTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |