KIAA0583

Product ID	ORK01097
Accession No	AB011155
Description	discs, large homolog 5 (Drosophila)
Clone name	af01829
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7507 bp) Predicted protein sequence (1952 aa)
HaloTag ORF Clone	FHC01097
Flexi ORF Clone	FXC01097
Source	Human brain (amygdala)
Rouge ID	mKIAA0583 by Kazusa Mouse cDNA Project
Note	We replaced hj00729, former representative clones for KIAA0583 with af01829. (2005/08/06)

Length: 7507 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1647 bp
Genome contig ID	gi89161187r_79120557
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGCTTTAGTACAACAAATAAAGGTCAATTTCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGCTGTGTTTGAAGATGTGAGTTTTTAATCTCTTCCTAGTCAGTCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	79220557	79356384	32	99.7	Perfect prediction

Length: 1952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46795	100.0	Discs, large ho...	Homo sapiens
Q8TDM6	99.9	Disks large hom...	Homo sapiens
EAW54611	100.0	discs, large ho...	Homo sapiens
AAL83938	99.9	DLG5 [Homo sapi...	Homo sapiens
AAL83937	99.9	DLG5 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001315	39	122	PF00619	Caspase Recruitment
	IPR006907	160	249	PF04822	Protein of unknown function DUF622
	IPR001478	655	740	PF00595	PDZ/DHR/GLGF
	IPR001478	755	826	PF00595	PDZ/DHR/GLGF
	IPR001478	1383	1459	PF00595	PDZ/DHR/GLGF
	IPR001478	1534	1612	PF00595	PDZ/DHR/GLGF
	IPR011511	1630	1692	PF07653	Variant SH3
	IPR008144	1834	1873	PF00625	Guanylate kinase
HMMSmart	IPR001478	666	743	SM00228	PDZ/DHR/GLGF
	IPR001478	751	829	SM00228	PDZ/DHR/GLGF
	IPR001478	1391	1462	SM00228	PDZ/DHR/GLGF
	IPR001478	1543	1615	SM00228	PDZ/DHR/GLGF
	IPR001452	1629	1693	SM00326	Src homology-3
	IPR008145	1755	1941	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR001315	34	123	PS50209	Caspase Recruitment
	IPR001478	653	743	PS50106	PDZ/DHR/GLGF
	IPR001478	738	829	PS50106	PDZ/DHR/GLGF
	IPR001478	1383	1462	PS50106	PDZ/DHR/GLGF
	IPR001478	1534	1615	PS50106	PDZ/DHR/GLGF
	IPR001452	1626	1694	PS50002	Src homology-3
	IPR008144	1808	1938	PS50052	Guanylate kinase
ScanRegExp	IPR000408	1549	1559	PS00626	Regulator of chromosome condensation

Primer_f	ACAAGTTTCAGTCCTCAATGC
Primer_r	GAAAATCCCAGTCTGTCAGCT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACAAGTTTCAGTCCTCAATGC
Primer_r	GAAAATCCCAGTCTGTCAGCT
PCR product length	206 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles