KIAA1941

Product ID	ORK06809
Accession No	AB075821
Description	small G protein signaling modulator 1
Clone name	ah04470
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6029 bp) Predicted protein sequence (1233 aa)
Source	Human brain (amygdala)

Length: 6029 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1082 bp
Genome contig ID	gi89161203f_23469427
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCCGGGCGACAGTTCAAGACTCCATCTC
Flanking genome sequence (181898 - 181947)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAAGGCACACAAGAGTCCCTCACACATCTCTCTTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	23569427	23651323	22	99.7	Internal No-hit

Length: 1233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH16622	0	100.0	RUN and TBC1 do...	Homo sapiens
NP_001091968	0	86.4	RUN and TBC1 do...	Homo sapiens
NP_597711	0	82.5	RUN and TBC1 do...	Homo sapiens
XP_001171390	0	82.2	RUN and TBC1 do...	Pan troglodytes
BAF63511	2.3e-188	82.1	small G protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007857	1.4e-60	50.5	KIAA0397
AB011180	5.8e-05	21.6	KIAA0608
AB028978	0.00016	25.1	KIAA1055
AB037743	0.00074	24.1	KIAA1322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	87	231	PF02759	RUN
	IPR004012	264	389	PF02759	RUN
	IPR000195	1003	1192	PF00566	RabGAP/TBC
HMMSmart	IPR004012	170	230	SM00593	RUN
	IPR004012	332	388	SM00593	RUN
	IPR000195	975	1193	SM00164	RabGAP/TBC
ProfileScan	IPR004012	79	233	PS50826	RUN
	IPR004012	254	391	PS50826	RUN
	IPR000195	763	1166	PS50086	RabGAP/TBC

Primer_f	ACGAGTTCATGTCCATCACGG
Primer_r	CTCGTTGGCAGAAGTAGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-