Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00087 |
---|---|
Accession No | AB007945 |
Description | DENN/MADD domain containing 4B |
Clone name | ah04654 |
Vector information | |
cDNA sequence | DNA sequence (5688 bp) Predicted protein sequence (1626 aa) |
HaloTag ORF Clone |
FHC00087
|
Flexi ORF Clone | FXC00087 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0476
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00487, former representative clones for KIAA0476 with ah04654. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 796 bp |
---|---|
Genome contig ID | gi89161185r_152068601 |
PolyA signal sequence (AGTAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 152168601 | 152185778 | 28 | 99.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005113 | 321 | 409 | PF03456 | uDENN |
IPR001194 | 443 | 627 | PF02141 | DENN | |
IPR005112 | 692 | 766 | PF03455 | dDENN | |
IPR002885 | 944 | 978 | PF01535 | Pentatricopeptide repeat | |
HMMSmart | IPR005113 | 302 | 409 | SM00800 | uDENN |
IPR001194 | 443 | 627 | SM00799 | DENN | |
IPR005112 | 692 | 766 | SM00801 | dDENN | |
HMMTigr | IPR002885 | 944 | 978 | TIGR00756 | Pentatricopeptide repeat |
ProfileScan | IPR005113 | 136 | 415 | PS50946 | uDENN |
IPR001194 | 443 | 627 | PS50211 | DENN | |
IPR005112 | 692 | 766 | PS50947 | dDENN |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 527 | SFLQLLQSLGPELAITLLLAVLT | 549 | SECONDARY | 23 | 2 | 560 | PDLLTSVCEALVSMIFPLHWQCP | 582 | SECONDARY | 23 | 3 | 586 | LCPLVLADVLSAPVPFIVGIHSS | 608 | PRIMARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCCATAAGAACCTCATAAGC |
Primer_r | AATAATGGTCCCTCTTCCCTG |
PCR product length | 135 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |