Order Kazusa clone(s) from : ![]() |
Product ID | ORK01667 |
---|---|
Accession No | AB007900 |
Description | signal-induced proliferation-associated 1 like 1, transcript variant 1 |
Clone name | ah05029 |
Vector information | |
cDNA sequence | DNA sequence (5737 bp) Predicted protein sequence (1817 aa) |
HaloTag ORF Clone |
FHC01667
![]() |
Flexi ORF Clone | FXC01667 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0440
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00452, former representative clones for KIAA0440 with ah05029. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 240 bp |
---|---|
Genome contig ID | gi51511730f_71024258 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (251615 - 251664) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 71124258 | 71275871 | 21 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | CCCAAGTCCCCAAACAAAATG |
---|---|
Primer_r | ACATCCAAGCATTCTGAAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCCAAGTCCCCAAACAAAATG |
Primer_r | ACATCCAAGCATTCTGAAGTC |
PCR product length | 80 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |