Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05034 |
---|---|
Accession No | AK024421 |
Clone name | as00010 |
Vector information | |
cDNA sequence | DNA sequence (4126 bp) Predicted protein sequence (772 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004841 | 9 | 394 | PF00324 | Amino acid permease-associated region |
ProfileScan | IPR002293 | 125 | 295 | PS50285 | Amino acid/polyamine transporter I |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | NLLYGSLLLGLVGGVCTLGAGLY | 47 | PRIMARY | 23 | 2 | 52 | FLTFLLVSGSLASVLISFVAVGP | 74 | PRIMARY | 23 | 3 | 118 | TTGAVMNFASVFAVLFNGCTGIM | 140 | SECONDARY | 23 | 4 | 158 | LGTIVAVAYTFFVYVLLFFLSSF | 180 | PRIMARY | 23 | 5 | 199 | LWPPLVLIGIYATALSASMSSLI | 221 | SECONDARY | 23 | 6 | 250 | GNPWAAVLYSWGLVQLVLLAGKL | 272 | SECONDARY | 23 | 7 | 278 | VVTVFYLVAYAAVDLSCLSLEWA | 300 | PRIMARY | 23 | 8 | 323 | SCLLMMFLISPGAAGGSLLLMGL | 345 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GAAGGCTTTTGTGGATCTAAC |
---|---|
Primer_r | TGGAGCGTCATCGTAGAAACC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |