FLJ00012

Gene/Protein Characteristic Table for FLJ00012

Order Kazusa clone(s) from :

Product ID	ORK04204
Accession No	AK024423
Clone name	as00012
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4577 bp) Predicted protein sequence (182 aa)
Source	Human spleen
Rouge ID	mFLJ00012 by Kazusa Mouse cDNA Project

Length: 4577 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Features of the protein sequence

Description

Length: 182 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15713	9.4e-75	100.0	FLJ00012 protei...	Homo sapiens
CAH56355	9.7e-43	100.0	hypothetical pr...	Homo sapiens
EAW74875	1.1e-42	100.0	ATG16 autophagy...	Homo sapiens
EAW74877	1.4e-42	100.0	ATG16 autophagy...	Homo sapiens
AAH36713	1.5e-42	100.0	ATG16L2 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	47	84	PF00400	G-protein beta WD-40 repeat
HMMPfam	IPR001680	91	128	PF00400	G-protein beta WD-40 repeat
HMMSmart	IPR001680	45	84	SM00320	G-protein beta WD-40 repeat
HMMSmart	IPR001680	89	128	SM00320	G-protein beta WD-40 repeat
ProfileScan	IPR001680	52	85	PS50082	G-protein beta WD-40 repeat
	IPR001680	52	137	PS50294	G-protein beta WD-40 repeat
	IPR001680	96	137	PS50082	G-protein beta WD-40 repeat
ScanRegExp	IPR001680	71	85	PS00678	G-protein beta WD-40 repeat

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CGATGGCTTCAAGTGTGGTTC
Primer_r	AATGGGGTCCCTGTAGTCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp