Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05036 |
---|---|
Accession No | AK024426 |
Clone name | as00015 |
Vector information | |
cDNA sequence | DNA sequence (4737 bp) Predicted protein sequence (307 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000832 | 17 | 269 | PF00002 | G-protein coupled receptor family 2 (secretin-like) |
ProfileScan | IPR000832 | 20 | 266 | PS50261 | G-protein coupled receptor family 2 (secretin-like) |
NULL | 28 | 110 | PS50319 | NULL |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 22 | VITYMGLSVSLLCLLLAALTFLL | 44 | PRIMARY | 23 | 2 | 54 | SLHLQLSLCLFLAHLLFLVAIDQ | 76 | PRIMARY | 23 | 3 | 85 | IIAGTLHYLYLATLTWMLLEALY | 107 | PRIMARY | 23 | 4 | 130 | LMFPVGYGVPAVTVAISAASRP | 151 | SECONDARY | 22 | 5 | 174 | GPVCAIFSVNLVLFLVTLWILK | 195 | SECONDARY | 22 | 6 | 218 | ATAQLFILGCTWCLGILQVGPAA | 240 | PRIMARY | 23 | 7 | 246 | LFTIINSLQGVFIFLVYCLLSQQ | 268 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GCTATAGAACGTTAAGACCTC |
---|---|
Primer_r | ATCGTGGTGTGAACATTCTAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |