Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01030 |
---|---|
Accession No | AK024429 |
Clone name | as00018 |
Vector information | |
cDNA sequence | DNA sequence (4703 bp) Predicted protein sequence (1430 aa) |
HaloTag ORF Clone |
FHC01030
|
Flexi ORF Clone | FXC01030 |
Source | Human spleen |
Rouge ID |
mFLJ00018
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000219 | 150 | 326 | PF00621 | DH domain |
IPR001849 | 352 | 455 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR000219 | 150 | 326 | SM00325 | DH domain |
IPR001849 | 352 | 457 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000219 | 146 | 327 | PS50010 | DH domain |
IPR001849 | 357 | 455 | PS50003 | Pleckstrin-like | |
IPR000694 | 1111 | 1228 | PS50099 | Proline-rich region |
RT-PCR-ELISA |
Primer_f | CAGAGGAGCGAGGATTTTGAC |
---|---|
Primer_r | ACTTGAGAATGCGCTGGACAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |