|
Order Kazusa clone(s) from : |
| Product ID | ORK01030 |
|---|---|
| Accession No | AK024429 |
| Clone name | as00018 |
| Vector information | |
| cDNA sequence | DNA sequence (4703 bp) Predicted protein sequence (1430 aa) |
|
HaloTag ORF Clone |
FHC01030
|
| Flexi ORF Clone | FXC01030 |
| Source | Human spleen |
| Rouge ID |
mFLJ00018
by Kazusa Mouse cDNA Project
|
Length: 4703 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 1430 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000219 | 150 | 326 | PF00621 | DH domain |
| IPR001849 | 352 | 455 | PF00169 | Pleckstrin-like | |
| HMMSmart | IPR000219 | 150 | 326 | SM00325 | DH domain |
| IPR001849 | 352 | 457 | SM00233 | Pleckstrin-like | |
| ProfileScan | IPR000219 | 146 | 327 | PS50010 | DH domain |
| IPR001849 | 357 | 455 | PS50003 | Pleckstrin-like | |
| IPR000694 | 1111 | 1228 | PS50099 | Proline-rich region |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CAGAGGAGCGAGGATTTTGAC |
|---|---|
| Primer_r | ACTTGAGAATGCGCTGGACAG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |