Gene/Protein Characteristic Table for FLJ00018
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01030
Accession No AK024429
Clone name as00018
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4703 bp)
Predicted protein sequence (1430 aa)
Flexi ORF Clone FXC01030
Source Human spleen
Rouge ID mFLJ00018 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4703 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1430 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15719 0 100.0 FLJ00018 protei...
Homo sapiens
Q9H7P9 0 100.0 Pleckstrin homo...
Homo sapiens
EAW56891 0 99.9 pleckstrin homo...
Homo sapiens
XP_001086919 0 95.1 similar to plec...
Macaca mulatta
EAW56887 0 96.6 pleckstrin homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033035 2.4e-10 28.3 KIAA1209
AB002360 1.9e-06 27.9 KIAA0362
AK160371 3.6e-06 30.9 FLJ00298
AB029035 9.2e-06 30.2 KIAA1112
AB007884 1.9e-05 29.4 KIAA0424
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 150 326 PF00621 DH domain
IPR001849 352 455 PF00169 Pleckstrin-like
HMMSmart IPR000219 150 326 SM00325 DH domain
IPR001849 352 457 SM00233 Pleckstrin-like
ProfileScan IPR000219 146 327 PS50010 DH domain
IPR001849 357 455 PS50003 Pleckstrin-like
IPR000694 1111 1228 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAGAGGAGCGAGGATTTTGAC
Primer_r ACTTGAGAATGCGCTGGACAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp