Gene/Protein Characteristic Table for FLJ00043
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04859
Accession No AK024451
Clone name as00043
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4421 bp)
Predicted protein sequence (1415 aa)
Source Human spleen
Rouge ID mFLJ00043 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4421 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1415 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15741 0 100.0 FLJ00043 protei...
Homo sapiens
Q8N3D4 0 99.7 EH domain-bindi...
Homo sapiens
CAD39093 0 99.7 hypothetical pr...
Homo sapiens
XP_001149120 0 98.6 hypothetical pr...
Pan troglodytes
XP_001118116 0 91.4 similar to tang...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020710 1.6e-14 32.9 KIAA0903
AK074068 4.6e-05 29.9 FLJ00139
AB037785 0.00022 44.2 KIAA1364
AB020626 0.00043 26.6 KIAA0819
AB051455 0.00064 27.2 KIAA1668
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001715 931 1034 PF00307 Calponin-like actin-binding
HMMSmart IPR001715 931 1029 SM00033 Calponin-like actin-binding
ProfileScan NULL 453 782 PS50313 NULL
IPR001715 929 1031 PS50021 Calponin-like actin-binding
IPR000694 1208 1239 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCCGAGCATTGAGGATAAAGG
Primer_r TTGACAAACTGCTGAACTCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp