Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04859 |
---|---|
Accession No | AK024451 |
Clone name | as00043 |
Vector information | |
cDNA sequence | DNA sequence (4421 bp) Predicted protein sequence (1415 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00043
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001715 | 931 | 1034 | PF00307 | Calponin-like actin-binding |
HMMSmart | IPR001715 | 931 | 1029 | SM00033 | Calponin-like actin-binding |
ProfileScan | NULL | 453 | 782 | PS50313 | NULL |
IPR001715 | 929 | 1031 | PS50021 | Calponin-like actin-binding | |
IPR000694 | 1208 | 1239 | PS50099 | Proline-rich region |
RT-PCR-ELISA |
Primer_f | CCCGAGCATTGAGGATAAAGG |
---|---|
Primer_r | TTGACAAACTGCTGAACTCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |