Gene/Protein Characteristic Table for FLJ00048
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05047
Accession No AK024456
Clone name as00048
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4314 bp)
Predicted protein sequence (146 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4314 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 146 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15746 2.3e-57 100.0 FLJ00048 protei...
Homo sapiens
BAG62589 8.3e-27 97.5 unnamed protein...
Homo sapiens
Q7Z6J4 1e-26 98.8 FYVE, RhoGEF an...
Homo sapiens
CAI20471 1.1e-26 98.8 FYVE, RhoGEF an...
Homo sapiens
XP_001173495 2.5e-26 97.5 FYVE, RhoGEF an...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATAATCCAGGGGGTACCACTC
Primer_r TGGGAACATGCTGAGTAAGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp