Gene/Protein Characteristic Table for FLJ00056
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05054
Accession No AK024463
Clone name as00056
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4471 bp)
Predicted protein sequence (1310 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4471 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1310 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15753 0 100.0 FLJ00056 protei...
Homo sapiens
Q8TER5 0 99.9 Protein SOLO.
Homo sapiens
BAB84883 0 99.9 FLJ00128 protei...
Homo sapiens
NP_060541 0 99.8 hypothetical pr...
Homo sapiens
XP_001095724 0 93.7 similar to quat...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK074057 0 99.9 FLJ00128
AK024475 3.7e-35 32.4 FLJ00068
AB067496 9.3e-26 31.0 KIAA1909
AB007979 8.2e-11 90.3 KIAA0510
AB051542 5.8e-05 25.2 KIAA1755
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR001849 1057 1165 SM00233 Pleckstrin-like
ProfileScan NULL 67 186 PS50315 NULL
IPR000219 876 1044 PS50010 DH domain
IPR001849 1056 1163 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTCGCCATGTCTTTCTCTTCG
Primer_r CGAAACCACAACTCAAAGCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp