Gene/Protein Characteristic Table for FLJ00064
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04589
Accession No AK024471
Clone name as00064
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4519 bp)
Predicted protein sequence (276 aa)
Source Human spleen
Rouge ID mFLJ00064 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4519 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 276 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15761 5.4e-124 100.0 FLJ00064 protei...
Homo sapiens
EAW66557 7.1e-124 100.0 CNDP dipeptidas...
Homo sapiens
EAW66553 6.3e-102 100.0 CNDP dipeptidas...
Homo sapiens
BAG60563 1e-100 97.5 unnamed protein...
Homo sapiens
BAG62540 1.2e-100 97.5 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002933 1 275 PF01546 Peptidase M20
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TAGACGAGCTGATTTTTGCCC
Primer_r AATGGAGGTCTTTGTTGCTGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp