Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01033 |
---|---|
Accession No | AK024477 |
Clone name | as00070 |
Vector information | |
cDNA sequence | DNA sequence (4439 bp) Predicted protein sequence (1382 aa) |
HaloTag ORF Clone |
FHC01033
|
Flexi ORF Clone | FXC01033 |
Source | Human spleen |
Rouge ID |
mFLJ00070
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001438 | 695 | 706 | PR00010 | Type II EGF-like signature |
IPR001438 | 818 | 825 | PR00010 | Type II EGF-like signature | |
IPR001438 | 967 | 977 | PR00010 | Type II EGF-like signature | |
HMMPfam | IPR006209 | 192 | 219 | PF00008 | EGF-like domain |
IPR002212 | 366 | 409 | PF00683 | Matrix fibril-associated | |
NULL | 434 | 473 | PF07645 | NULL | |
IPR002212 | 492 | 533 | PF00683 | Matrix fibril-associated | |
NULL | 695 | 737 | PF07645 | NULL | |
NULL | 739 | 771 | PF07645 | NULL | |
NULL | 782 | 821 | PF07645 | NULL | |
NULL | 823 | 862 | PF07645 | NULL | |
NULL | 864 | 903 | PF07645 | NULL | |
IPR006209 | 868 | 903 | PF00008 | EGF-like domain | |
NULL | 905 | 943 | PF07645 | NULL | |
NULL | 945 | 986 | PF07645 | NULL | |
IPR006209 | 949 | 986 | PF00008 | EGF-like domain | |
IPR002212 | 1006 | 1049 | PF00683 | Matrix fibril-associated | |
NULL | 1072 | 1113 | PF07645 | NULL | |
NULL | 1115 | 1154 | PF07645 | NULL | |
IPR006209 | 1119 | 1154 | PF00008 | EGF-like domain | |
NULL | 1161 | 1200 | PF07645 | NULL | |
IPR002212 | 1225 | 1270 | PF00683 | Matrix fibril-associated | |
NULL | 1333 | 1376 | PF07645 | NULL | |
HMMSmart | IPR006210 | 191 | 220 | SM00181 | Type I EGF |
IPR001881 | 192 | 220 | SM00179 | EGF-like calcium-binding | |
IPR001881 | 434 | 474 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 437 | 474 | SM00181 | Type I EGF | |
IPR001881 | 653 | 694 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 656 | 694 | SM00181 | Type I EGF | |
IPR001881 | 695 | 738 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 698 | 738 | SM00181 | Type I EGF | |
IPR001881 | 739 | 781 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 742 | 781 | SM00181 | Type I EGF | |
IPR001881 | 782 | 822 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 785 | 822 | SM00181 | Type I EGF | |
IPR001881 | 823 | 863 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 826 | 863 | SM00181 | Type I EGF | |
IPR001881 | 864 | 904 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 867 | 904 | SM00181 | Type I EGF | |
IPR001881 | 905 | 944 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 908 | 944 | SM00181 | Type I EGF | |
IPR001881 | 945 | 987 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 948 | 987 | SM00181 | Type I EGF | |
IPR001881 | 1072 | 1114 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1075 | 1114 | SM00181 | Type I EGF | |
IPR001881 | 1115 | 1155 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1118 | 1155 | SM00181 | Type I EGF | |
IPR001881 | 1161 | 1201 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1164 | 1201 | SM00181 | Type I EGF | |
IPR001881 | 1296 | 1332 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1299 | 1332 | SM00181 | Type I EGF | |
IPR001881 | 1333 | 1377 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1336 | 1377 | SM00181 | Type I EGF | |
ProfileScan | IPR000694 | 25 | 84 | PS50099 | Proline-rich region |
NULL | 83 | 246 | PS50315 | NULL | |
NULL | 434 | 474 | PS50034 | NULL | |
NULL | 653 | 694 | PS50034 | NULL | |
NULL | 657 | 973 | PS50311 | NULL | |
NULL | 695 | 738 | PS50034 | NULL | |
NULL | 739 | 781 | PS50034 | NULL | |
NULL | 782 | 822 | PS50034 | NULL | |
NULL | 823 | 863 | PS50034 | NULL | |
NULL | 864 | 904 | PS50034 | NULL | |
NULL | 905 | 944 | PS50034 | NULL | |
NULL | 945 | 987 | PS50034 | NULL | |
NULL | 1072 | 1114 | PS50034 | NULL | |
NULL | 1115 | 1155 | PS50034 | NULL | |
NULL | 1161 | 1201 | PS50034 | NULL | |
NULL | 1333 | 1377 | PS50034 | NULL | |
ScanRegExp | IPR006209 | 208 | 219 | PS00022 | EGF-like domain |
IPR001881 | 434 | 458 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 449 | 460 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 678 | 693 | PS01186 | EGF-like domain | |
IPR001881 | 695 | 720 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 711 | 722 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR001881 | 739 | 764 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 755 | 766 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR001881 | 782 | 806 | PS01187 | EGF-like calcium-binding | |
IPR001881 | 823 | 847 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 838 | 849 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 847 | 862 | PS01186 | EGF-like domain | |
IPR001881 | 864 | 888 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 879 | 890 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 888 | 903 | PS01186 | EGF-like domain | |
IPR001881 | 905 | 929 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 920 | 931 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR001881 | 945 | 971 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 962 | 973 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 971 | 986 | PS01186 | EGF-like domain | |
IPR001881 | 1072 | 1098 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1089 | 1100 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 1098 | 1113 | PS01186 | EGF-like domain | |
IPR001881 | 1115 | 1139 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1130 | 1141 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR001881 | 1161 | 1185 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1176 | 1187 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 1185 | 1200 | PS01186 | EGF-like domain | |
IPR006209 | 1316 | 1331 | PS01186 | EGF-like domain | |
IPR001881 | 1333 | 1361 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1352 | 1363 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR006209 | 1361 | 1376 | PS01186 | EGF-like domain |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 98 | AGAAGLLALLLLLLLLLGLGGRV | 120 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | AGAGCAAGTGCCACAAGTGTC |
---|---|
Primer_r | ATAGGAGCCAGGGTTGTTGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |