Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05067 |
---|---|
Accession No | AK024488 |
Clone name | as00087 |
Vector information | |
cDNA sequence | DNA sequence (4287 bp) Predicted protein sequence (674 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00087
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 37 | 115 | PF00168 | C2 domain |
IPR001936 | 210 | 382 | PF00616 | Ras GTPase-activating protein | |
HMMSmart | IPR001936 | 138 | 460 | SM00323 | Ras GTPase-activating protein |
ProfileScan | IPR001936 | 189 | 381 | PS50018 | Ras GTPase-activating protein |
NULL | 520 | 560 | PS50323 | NULL |
RT-PCR-ELISA |
Primer_f | AGTACATGAAGCTCGTGGCAC |
---|---|
Primer_r | AGGGAACCAGTCGTAGGAATG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |