FLJ00106

Gene/Protein Characteristic Table for FLJ00106

Order Kazusa clone(s) from :

Product ID	ORK01034
Accession No	AK024498
Clone name	as00106
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4551 bp) Predicted protein sequence (379 aa)
HaloTag ORF Clone	FHC01034
Flexi ORF Clone	FXC01034
Source	Human spleen

Length: 4551 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Features of the protein sequence

Description

Length: 379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15788	7.7e-126	100.0	FLJ00106 protei...	Homo sapiens
AAO45102	2.1e-121	100.0	PDZ-LIM protein...	Homo sapiens
XP_001156781	4.6e-121	99.5	similar to FLJ0...	Pan troglodytes
XP_001156661	8.2e-121	99.5	similar to FLJ0...	Pan troglodytes
EAW63664	1.2e-107	100.0	PDZ and LIM dom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014513	6.5e-06	29.0	KIAA0613

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	299	340	PD000094	Zn-binding protein
HMMPfam	IPR001478	16	94	PF00595	PDZ/DHR/GLGF domain
HMMSmart	IPR001478	24	97	SM00228	PDZ/DHR/GLGF domain
ProfileScan	IPR001478	13	97	PS50106	PDZ/DHR/GLGF domain
ProfileScan	NULL	127	174	PS50324	NULL

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGTCTCAGGAACTCATGGCAG
Primer_r	TGACCCAACACCCAAAGTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp