Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05081 |
---|---|
Accession No | AK024503 |
Clone name | as00112 |
Vector information | |
cDNA sequence | DNA sequence (4575 bp) Predicted protein sequence (1192 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000538 | 835 | 931 | PD000918 | Link |
HMMPfam | IPR006209 | 158 | 194 | PF00008 | EGF-like domain |
IPR000782 | 249 | 367 | PF02469 | Beta-Ig-H3/fasciclin | |
IPR000782 | 393 | 524 | PF02469 | Beta-Ig-H3/fasciclin | |
IPR006209 | 692 | 721 | PF00008 | EGF-like domain | |
IPR006209 | 727 | 762 | PF00008 | EGF-like domain | |
IPR006209 | 768 | 805 | PF00008 | EGF-like domain | |
IPR000538 | 838 | 931 | PF00193 | Link | |
HMMSmart | IPR006210 | 35 | 69 | SM00181 | Type I EGF |
IPR006210 | 76 | 111 | SM00181 | Type I EGF | |
IPR006210 | 115 | 153 | SM00181 | Type I EGF | |
IPR006210 | 157 | 195 | SM00181 | Type I EGF | |
IPR006210 | 199 | 237 | SM00181 | Type I EGF | |
IPR006210 | 599 | 639 | SM00181 | Type I EGF | |
IPR006210 | 649 | 683 | SM00181 | Type I EGF | |
IPR006210 | 691 | 722 | SM00181 | Type I EGF | |
IPR006210 | 726 | 763 | SM00181 | Type I EGF | |
IPR006210 | 767 | 806 | SM00181 | Type I EGF | |
IPR000538 | 837 | 932 | SM00445 | Link | |
ProfileScan | NULL | 13 | 225 | PS50311 | NULL |
IPR000782 | 237 | 365 | PS50213 | Beta-Ig-H3/fasciclin | |
IPR000782 | 381 | 522 | PS50213 | Beta-Ig-H3/fasciclin | |
NULL | 578 | 794 | PS50311 | NULL | |
IPR000782 | 952 | 1087 | PS50213 | Beta-Ig-H3/fasciclin | |
ScanRegExp | IPR006209 | 13 | 24 | PS00022 | EGF-like domain |
IPR006209 | 13 | 27 | PS01186 | EGF-like domain | |
IPR002049 | 13 | 47 | PS01248 | Laminin-type EGF-like domain | |
IPR006209 | 57 | 68 | PS00022 | EGF-like domain | |
IPR006209 | 57 | 68 | PS01186 | EGF-like domain | |
IPR006209 | 97 | 110 | PS01186 | EGF-like domain | |
IPR006209 | 139 | 152 | PS01186 | EGF-like domain | |
IPR006209 | 627 | 638 | PS00022 | EGF-like domain | |
IPR006209 | 627 | 641 | PS01186 | EGF-like domain | |
IPR002049 | 627 | 661 | PS01248 | Laminin-type EGF-like domain | |
IPR006209 | 671 | 682 | PS00022 | EGF-like domain | |
IPR006209 | 671 | 682 | PS01186 | EGF-like domain | |
IPR006209 | 749 | 762 | PS01186 | EGF-like domain | |
IPR006209 | 938 | 951 | PS01186 | EGF-like domain |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1102 | GAGIFFAIILVTGAVALAAYSY | 1123 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | ATCTTCTTTGCCATCATCCTG |
---|---|
Primer_r | TACAAGGGGTTCGAGATATTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |