FLJ00116

Product ID	ORK04322
Accession No	AK024506
Clone name	as00116
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4433 bp) Predicted protein sequence (169 aa)
Source	Human spleen
Rouge ID	mFLJ00116 by Kazusa Mouse cDNA Project

Length: 4433 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Length: 169 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15796	6e-67	100.0	FLJ00116 protei...	Homo sapiens
EAW81929	7.8e-67	100.0	hCG2029376, iso...	Homo sapiens
EAW81928	8.9e-67	100.0	hCG2029376, iso...	Homo sapiens
NP_001128349	1e-66	100.0	hypothetical pr...	Homo sapiens
CAD61932	1e-66	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	TGAGCCCTGGATAGCATAGAC
Primer_r	AGACCCCCAGAAAGAAGGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles