Order Kazusa clone(s) from : ![]() |
Product ID | ORK00965 |
---|---|
Accession No | AB082522 |
Description | ring finger protein 169 |
Clone name | bf00209 |
Vector information | |
cDNA sequence | DNA sequence (7811 bp) Predicted protein sequence (712 aa) |
HaloTag ORF Clone |
FHC00965
![]() |
Flexi ORF Clone | FXC00965 |
Source | Human adult brain |
Rouge ID |
mKIAA1991
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 5671 bp |
---|---|
Genome contig ID | gi51511727f_74037561 |
PolyA signal sequence (AGTAAA,-14) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (193536 - 193585) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 74137561 | 74231095 | 6 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTAGGGTCAACTCCAGATGCC |
---|---|
Primer_r | TGGCTCTTCACTTAGGCTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |