KIAA1991

Product ID	ORK00965
Accession No	AB082522
Description	ring finger protein 169
Clone name	bf00209
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7811 bp) Predicted protein sequence (712 aa)
HaloTag ORF Clone	FHC00965
Flexi ORF Clone	FXC00965
Source	Human adult brain
Rouge ID	mKIAA1991 by Kazusa Mouse cDNA Project

Length: 7811 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5671 bp
Genome contig ID	gi51511727f_74037561
PolyA signal sequence (AGTAAA,-14)	+--------+--------+----*----+---- CAAGGCCCAAGTTGAGAATACAGTAAAGGAAACTC
Flanking genome sequence (193536 - 193585)	----+--------+--------+--------+--------+----* ATGAAAGTGGATGTTCTGTTTATAGTCAGAGTCTTGTCTCTGGTGAACAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	74137561	74231095	6	99.1	Perfect prediction

Length: 712 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_522106	0	99.4	similar to RING...	Pan troglodytes
Q8NCN4	0	100.0	RING finger pro...	Homo sapiens
EAW74948	0	98.9	hCG1644049, iso...	Homo sapiens
XP_001082831	0	96.4	similar to ring...	Macaca mulatta
XP_851632	2e-200	86.5	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	72	110	PF00097	Zinc finger
HMMSmart	IPR001841	72	110	SM00184	Zinc finger
ProfileScan	IPR001841	72	111	PS50089	Zinc finger
ScanRegExp	IPR001841	87	96	PS00518	Zinc finger

Primer_f	TTAGGGTCAACTCCAGATGCC
Primer_r	TGGCTCTTCACTTAGGCTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-