Gene/Protein Characteristic Table for KIAA1991
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00965
Accession No AB082522
Description ring finger protein 169
Clone name bf00209
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (7811 bp)
Predicted protein sequence (712 aa)
Flexi ORF Clone FXC00965
Source Human adult brain
Rouge ID mKIAA1991 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 7811 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 5671 bp
Genome contig ID gi51511727f_74037561
PolyA signal sequence
(AGTAAA,-14)
+----*----+----*----+----*----+----
CAAGGCCCAAGTTGAGAATACAGTAAAGGAAACTC
Flanking genome sequence
(193536 - 193585)
----+----*----+----*----+----*----+----*----+----*
ATGAAAGTGGATGTTCTGTTTATAGTCAGAGTCTTGTCTCTGGTGAACAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 11 f 74137561 74231095 6 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 712 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_522106 0 99.4 similar to RING...
Pan troglodytes
Q8NCN4 0 100.0 RING finger pro...
Homo sapiens
EAW74948 0 98.9 hCG1644049, iso...
Homo sapiens
XP_001082831 0 96.4 similar to ring...
Macaca mulatta
XP_851632 2e-200 86.5 hypothetical pr...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 72 110 PF00097 Zinc finger
HMMSmart IPR001841 72 110 SM00184 Zinc finger
ProfileScan IPR001841 72 111 PS50089 Zinc finger
ScanRegExp IPR001841 87 96 PS00518 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTAGGGTCAACTCCAGATGCC
Primer_r TGGCTCTTCACTTAGGCTCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp